View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_low_33 (Length: 262)
Name: NF16486_low_33
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_low_33 |
 | |
|
| [»] scaffold1034 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1034 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 2421 - 2252
Alignment:
| Q |
19 |
atgcgtttacaaaccaaccct-tcatttgttttcatttgatttgaccgctcagttaactcaaaggacaaatttggtataaagtcacattcatcataacat |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2421 |
atgcgtttacaaaccaaccccctcatttgttttcatttgatttgaccgctcagttaactcaaaggacaaatttggtataaagtcacattcatcataacat |
2322 |
T |
|
| Q |
118 |
acactgaaacattttatccannnnnnnnatttattatttaatcttttcaatcaatgattaactatataaact |
189 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2321 |
acactgaaaca-tttatccatttctttt-tttattatttaatcttttcaatcaatgattaactatataaact |
2252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1034; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 211 - 262
Target Start/End: Complemental strand, 2255 - 2204
Alignment:
| Q |
211 |
aacttgaactcacttgtttctgtcttagatttttactttgttgtgaattctt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2255 |
aacttgaactcacttgtttctgtcttagatttttactttattgtgaattctt |
2204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University