View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16486_low_35 (Length: 256)
Name: NF16486_low_35
Description: NF16486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16486_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 30311378 - 30311139
Alignment:
| Q |
1 |
ttttgcaattatggaaaatttcataacctatgcctcaatttgtcaaacaaaaaatctataaaaacaggttgcattttacgattttacaatttaagtattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30311378 |
ttttgcaattatggaaaatttcataacctatgcctcaatttgttaaacaaaaaatccataaaaacaggttgcattttacgattttacaatttaagtattc |
30311279 |
T |
 |
| Q |
101 |
atttttcagcgagtatcaactcatggtatggactatagtctatagaatcatggattacctcgttttgaccggggaatgcatctttgatggcttttctgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30311278 |
atttttcagcgagtatcaactcatggtatggactatagtctacagaatcatggattacctcgttttgaccggggaatgcatctttgatggcttttctgac |
30311179 |
T |
 |
| Q |
201 |
ttcttcgacggaggaaaccgcaacacctctcggaacgtta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30311178 |
ttcttcgacggaggaaaccgcaacacctctcggaacgtta |
30311139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University