View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16486_low_49 (Length: 224)

Name: NF16486_low_49

Description: NF16486

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF16486_low_49

[»] chr3 (1 HSPs)

[»] chr1 (1 HSPs)

Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 190; E-Value: 1e-103

Query Start/End: Original strand, 19 - 208

Target Start/End: Complemental strand, 47367605 - 47367416

Alignment:

Q	19	tattggtggaggtttaacggactactacaaagacactgttgcaatgggaacttttgcagccatagaacatggaatactagtatccagttcagcaggaaac	118	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	47367605	tattggtggaggtttaacggactactacaaagacactgttgcaatgggaacttttgcagccatagaacatggaatactagtatccagttcagcaggaaac	47367506	T

Q	119	ggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgatttccctgcctat	208	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	47367505	ggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgatttccctgcctat	47367416	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)

Name: chr1

Description:

Target: chr1; HSP #1

Raw Score: 37; E-Value: 0.000000000005

Query Start/End: Original strand, 106 - 198

Target Start/End: Original strand, 5375056 - 5375148

Alignment:

Q	106	ttcagcaggaaacggtggacctagtaaagcaagtttggctaatgttgcaccatggataaccactgtcggtgccggaactatagaccgcgattt	198	Q
		\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\| \| \|\|\| \|\|\| \| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\|\|\|
T	5375056	ttcagcaggaaatggtggaccaagtgctgaaagcttgtcaaatgtagcaccatggataacaactgttggtgccggaacaattgaccgcgattt	5375148	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]