View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16487_low_5 (Length: 239)
Name: NF16487_low_5
Description: NF16487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16487_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 6575918 - 6576121
Alignment:
| Q |
16 |
gatatgattcctgtgtgggtctacccaactttactagaaacaatattgtaagtgagttgattcggctttaatacctacagtcttgaactggtggggtttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6575918 |
gatatgattcctgtgtgggtctacccaactttactagaaacaatattgtatgtgagttgattcggctttaatacctacagtcttgaactggtggggtttt |
6576017 |
T |
 |
| Q |
116 |
gagttaactcgaaagatcgacaactattatagccacactttcattgtatatgtagtcaatggcatataatggacgacccccacaatgcagcgggtagagg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6576018 |
gagttaactcgaaagttcgacaactattatagccacactttcattgtctatgtagtcaatggcatataatggacgacccccacaatacagcgggtagagg |
6576117 |
T |
 |
| Q |
216 |
tatg |
219 |
Q |
| |
|
|||| |
|
|
| T |
6576118 |
tatg |
6576121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University