View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16487_low_5 (Length: 239)

Name: NF16487_low_5
Description: NF16487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16487_low_5
NF16487_low_5
[»] chr5 (1 HSPs)
chr5 (16-219)||(6575918-6576121)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 6575918 - 6576121
Alignment:
16 gatatgattcctgtgtgggtctacccaactttactagaaacaatattgtaagtgagttgattcggctttaatacctacagtcttgaactggtggggtttt 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6575918 gatatgattcctgtgtgggtctacccaactttactagaaacaatattgtatgtgagttgattcggctttaatacctacagtcttgaactggtggggtttt 6576017  T
116 gagttaactcgaaagatcgacaactattatagccacactttcattgtatatgtagtcaatggcatataatggacgacccccacaatgcagcgggtagagg 215  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||    
6576018 gagttaactcgaaagttcgacaactattatagccacactttcattgtctatgtagtcaatggcatataatggacgacccccacaatacagcgggtagagg 6576117  T
216 tatg 219  Q
    ||||    
6576118 tatg 6576121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University