View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16488_low_5 (Length: 254)
Name: NF16488_low_5
Description: NF16488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16488_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 12194578 - 12194731
Alignment:
| Q |
1 |
tcgtatttctgttttgcgctcaaattcaattttcttatacgcggtgttagttcttggtttcgtaatgcttcacgtttttctttttcgttcagttatttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12194578 |
tcgtatttctgttttgcgctcaaattcaattttcttatacgcggtgttaattcttggtttcgtaatgcttcacgtttttctttttcgttcagttatttaa |
12194677 |
T |
|
| Q |
101 |
-tannnnnnnnnatcgttgcggaactcgtgattgtgcttttggttgatagttta |
153 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12194678 |
tttaatttttttatcgttgcggaactcgtgactgtgcttttggttgatagttta |
12194731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 12289411 - 12289499
Alignment:
| Q |
1 |
tcgtatttctgttttgcgctcaaattcaattttcttatacgcggtgttagttcttggtttcgtaatgcttcacgtttttctttttcgtt |
89 |
Q |
| |
|
|||| ||||| |||| ||||||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12289411 |
tcgtttttcttttttccgctcaaattctattttcttgaaagcggtgttaattcttggtttcgtaatgcttcacgtttttctttttcgtt |
12289499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University