View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16489_high_4 (Length: 274)
Name: NF16489_high_4
Description: NF16489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16489_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 41050082 - 41049917
Alignment:
| Q |
1 |
cataggggaaacaagaaacttgagaaacagacgacatgaaatagacatcgaaaatcaagaatgaaaacttgtgaaattaaattgaacacacctacttgca |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41050082 |
cataagggaaacaagaaacttgagaaacagacgacatgaagtagacatcgaaaatcaagaatgaaaacttgtgaaattaaattgaacacacctacttgca |
41049983 |
T |
 |
| Q |
101 |
tcaaacagcttcagattcagaatcaaaagtagctgtcaacagttcgaaattcagacaaccataacc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41049982 |
tcaaacagcttcagattcagaatcaaaagtagctgtcaacagttcgaaattcagacaaccataacc |
41049917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 41049860 - 41049809
Alignment:
| Q |
223 |
ttggtgaaatatgcaaataagcgtaagaatagaaagttttccaaatttggca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41049860 |
ttggtgaaatatgcaaataagcgtaagaatagaaagttttccaaatttggca |
41049809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University