View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16489_low_6 (Length: 236)
Name: NF16489_low_6
Description: NF16489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16489_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41049820 - 41049595
Alignment:
| Q |
1 |
ccaaatttggcatccgtacagaaggaaaagtttgtgtatattttgggtcatatcatat-----gcaaccaattatttgcacagcttgatagaaattgatg |
95 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41049820 |
ccaaatttggcatccgtactgaaggaaaaatttgtgtatattttgggtcatatcatatcatatgcaactaattatttgcacagcttgatagaaattgatg |
41049721 |
T |
 |
| Q |
96 |
aagttgaaactgacctattgatgtagtgaggatcctccttcttttgagaatgaatagaagctgaacaagacctggttggtgaccttaatttacaacnnnn |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41049720 |
aagttgaaactgacctattgatgtagtgaggatcctccttcttttgagaatgaatagaagctgaacaagacctggttggtgaccttaatttacaacaaaa |
41049621 |
T |
 |
| Q |
196 |
nnngaaaagtagtacagtgaaaattc |
221 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
41049620 |
aaagaaaagtagtatagtgaaaattc |
41049595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University