View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16494_high_2 (Length: 347)
Name: NF16494_high_2
Description: NF16494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16494_high_2 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 219 - 347
Target Start/End: Complemental strand, 30902556 - 30902428
Alignment:
| Q |
219 |
ctgaattaaaccaagaaatggtacctattccatactagaattccttccaatttctattgtaattcctcactagtttactaatggaaatttgagttccttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902556 |
ctgaattaaaccaagaaatggtacctattacatactagaattccttccaatttctattgtaattcctcactagtttactaatggaaatttgagttccttt |
30902457 |
T |
|
| Q |
319 |
cacttacttcattgatatatcataacact |
347 |
Q |
| |
|
||||||||||||| ||||||||||||||| |
|
|
| T |
30902456 |
cacttacttcattcatatatcataacact |
30902428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 30902821 - 30902673
Alignment:
| Q |
1 |
aatgtcaatctccaaat----ctcgcttggtttcggacaattcacaaacaaatgttccgttgtctcaatgacactataagatagtatgtggtgatcattg |
96 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||| |
|
|
| T |
30902821 |
aatgtcaatctccaaattaatctcgcttgctttcggacaattcacaaacaaatgttccgttgtctcaatgacactataagcttgtgtgtggtgatcattg |
30902722 |
T |
|
| Q |
97 |
tctatacatacatagcgtacactcaatgataattaatgaaacactttca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902721 |
tctatacatacatagcgtacactcaatgataattaatgaaacactttca |
30902673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University