View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16494_high_3 (Length: 332)
Name: NF16494_high_3
Description: NF16494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16494_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 25 - 302
Target Start/End: Original strand, 6315070 - 6315347
Alignment:
| Q |
25 |
tcatcaacaactgcacaacaatgattatgaatggtttaactatggtgttgtggaatatatggaagagaagaagtaagcagctttggaatatgcctggcaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315070 |
tcatcaacaactgcacaacaatgattatgaatggtttaactatggtgttgtggaatatatggaagagaagaagtaagcagctttggaatatgcctggcaa |
6315169 |
T |
 |
| Q |
125 |
caatccaacaagctatttagttcccttttgttttgaaatggcaaaagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtaga |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315170 |
caatccaacaagctatttagttccctgttgttttgaaatggcaaaagaaaaagcagcaaaatacttagaatttggagattaacacgaggcatatagtaga |
6315269 |
T |
 |
| Q |
225 |
tggaaaaaaccacaacaggggtacttgtcatatggcaacaggtggattagtaacaacggagacttgttgggcagatgg |
302 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6315270 |
tggaaaagaccacaacaggggtacttgtcatatggcaacaggtggattagtagcaacggagacttgttgggcagatgg |
6315347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University