View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16494_high_4 (Length: 323)
Name: NF16494_high_4
Description: NF16494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16494_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 31 - 298
Target Start/End: Original strand, 42932128 - 42932395
Alignment:
| Q |
31 |
gtaagtaccttgcctaataaacttttcatgtgatgcataaagtaggtgtttttctcaactaataccaatatccattgaatgattttaggtatctatgccc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42932128 |
gtaagtaccttgcctaataaacttttcatgtgatgcataaagtaggtgttttcctcaactaatatcaatatccattgaatgattttaggtatctttgccc |
42932227 |
T |
 |
| Q |
131 |
taaagggggttgcagagaaatcaatggttatcctgcagattgttcgtaagttttaaatcatcatgtttctaattgcgtcgtgatgcttatcctgttatca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932228 |
taaagggggttgcagagaaatcaatggttatcctgcagattgttcgtaagttttaaatcatcatgtttctaattgcgtcgtgatgcttatcctgttatca |
42932327 |
T |
 |
| Q |
231 |
ttttcacaataactaaagttggttgcttcatccttaatcaggtttggaactgtttctgcaaatgtgat |
298 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42932328 |
ttttaacaataactaaagtcggttgcttcatccttaatcaggtttggaactgtttctgcaaatgtgat |
42932395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University