View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16495_high_15 (Length: 252)
Name: NF16495_high_15
Description: NF16495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16495_high_15 |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0005 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 170
Target Start/End: Complemental strand, 286581 - 286428
Alignment:
| Q |
18 |
gtatgaaggttctaagctgcttaaattcagaaaagatctcaaacttttctggatcatcatatataccttgtaaataagataaatggcgaacactagtcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
286581 |
gtatgaaggttctaagctgcttaaattcagaaaagatctcaaacttttctggatcatcatatataccttgtaaataagataaatggcgaacaatagtcgt |
286482 |
T |
 |
| Q |
118 |
gatttttcttggattgttatcatctaa-ttgtaacagaattcgcctacaacaaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
286481 |
gatttttcttggattgttatcatctaagttgtaacagaattcacctgcaacaaa |
286428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 163 - 237
Target Start/End: Original strand, 286289 - 286363
Alignment:
| Q |
163 |
acaacaaagaacggataagagaatggaagatgtaggagaagaatgctttgaagtgttgctatctagatcgttctt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
286289 |
acaacaaagaacggataagagaatggaagatgtaagagaagaatgctttgaagtgttactatctagatcgttctt |
286363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University