View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16496_high_7 (Length: 284)

Name: NF16496_high_7
Description: NF16496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16496_high_7
NF16496_high_7
[»] chr2 (4 HSPs)
chr2 (70-200)||(12194405-12194535)
chr2 (70-182)||(12289259-12289371)
chr2 (16-45)||(12194560-12194589)
chr2 (234-266)||(12194333-12194365)


Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 70 - 200
Target Start/End: Complemental strand, 12194535 - 12194405
Alignment:
70 tagaataaattcatattttgggaattggagaatgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaaaccctaaccataa 169  Q
    |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||    
12194535 tagaatcaattcatattttgggaattggagagtgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaatccccaaccataa 12194436  T
170 ccgaatttgtgaatgaagcttttgagaaaca 200  Q
    |||||||||||||||||||||||||||||||    
12194435 ccgaatttgtgaatgaagcttttgagaaaca 12194405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 70 - 182
Target Start/End: Complemental strand, 12289371 - 12289259
Alignment:
70 tagaataaattcatattttgggaattggagaatgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaaaccctaaccataa 169  Q
    |||||| |||||||| |||  ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||| ||||||||||||||||    
12289371 tagaatcaattcataattttcgaattagagaatgaaaattgagaatgagttgatttgtacaacattttgcaaaatgcgaattatgaaaccctaaccataa 12289272  T
170 ccgaatttgtgaa 182  Q
    |||||||||||||    
12289271 ccgaatttgtgaa 12289259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 45
Target Start/End: Complemental strand, 12194589 - 12194560
Alignment:
16 acagaaatacgaaaattagaggattacctt 45  Q
    ||||||||||||||||||||||||||||||    
12194589 acagaaatacgaaaattagaggattacctt 12194560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 266
Target Start/End: Complemental strand, 12194365 - 12194333
Alignment:
234 aaactaaccgagcgtgagagtgttgggactttg 266  Q
    |||||||||||||||||||||||| ||||||||    
12194365 aaactaaccgagcgtgagagtgttaggactttg 12194333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University