View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16496_low_12 (Length: 240)
Name: NF16496_low_12
Description: NF16496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16496_low_12 |
 |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 4955727 - 4955516
Alignment:
| Q |
20 |
tgatcatttttcccccggatggtcccccctttagatttgctccctgaatcgagcattagattttacagtattttctatgtccaattgctatacaaagaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955727 |
tgatcatttttcccccggatggtcccccttttagatttgctccctgaatcgagcattagattttacagtattttctatgtccaattgctatacaaagaag |
4955628 |
T |
 |
| Q |
120 |
gctaatttaattttagctaatggtggatatttttctatgt-ttttattttggtgcattattccgtacctgtacattacttttgcttcttacaggaagtag |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955627 |
gctaattgaattttagctaatggtggatatttttctatgttttttattttggtgcattattccgtacctgtacattacttttgcttcttacaggaagtag |
4955528 |
T |
 |
| Q |
219 |
ggagaaaatacc |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4955527 |
ggagaaaatacc |
4955516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 1719 - 1507
Alignment:
| Q |
20 |
tgatcatttttcccccggatggtcccccctttagatttgctccctgaatcgagcattagattttacagtattttctatgtccaattgctatacaaagaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1719 |
tgatcatttttcccccggatggtcccccttttagatttgctccctgaatcgagcattagattttacagtattttctatgtccaattgctatacaaagaag |
1620 |
T |
 |
| Q |
120 |
gctaatttaattttagctaatggtggatatttttctat--gtttttattttggtgcattattccgtacctgtacattacttttgcttcttacaggaagta |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1619 |
gctaattgaattttagctaatggtggatatttttctattgttttttattttggtgcattattccgtacctgtacattacttttgcttcttacaggaagta |
1520 |
T |
 |
| Q |
218 |
gggagaaaatacc |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1519 |
gggagaaaatacc |
1507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University