View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16496_low_8 (Length: 284)
Name: NF16496_low_8
Description: NF16496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16496_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 70 - 200
Target Start/End: Complemental strand, 12194535 - 12194405
Alignment:
| Q |
70 |
tagaataaattcatattttgggaattggagaatgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaaaccctaaccataa |
169 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
12194535 |
tagaatcaattcatattttgggaattggagagtgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaatccccaaccataa |
12194436 |
T |
 |
| Q |
170 |
ccgaatttgtgaatgaagcttttgagaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12194435 |
ccgaatttgtgaatgaagcttttgagaaaca |
12194405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 70 - 182
Target Start/End: Complemental strand, 12289371 - 12289259
Alignment:
| Q |
70 |
tagaataaattcatattttgggaattggagaatgaaaattgagaatgagttgatttgtacaacattatacgaaatgcgaattacgaaaccctaaccataa |
169 |
Q |
| |
|
|||||| |||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||| | | |||||||||||| |||||||||||||||| |
|
|
| T |
12289371 |
tagaatcaattcataattttcgaattagagaatgaaaattgagaatgagttgatttgtacaacattttgcaaaatgcgaattatgaaaccctaaccataa |
12289272 |
T |
 |
| Q |
170 |
ccgaatttgtgaa |
182 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12289271 |
ccgaatttgtgaa |
12289259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 45
Target Start/End: Complemental strand, 12194589 - 12194560
Alignment:
| Q |
16 |
acagaaatacgaaaattagaggattacctt |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12194589 |
acagaaatacgaaaattagaggattacctt |
12194560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 266
Target Start/End: Complemental strand, 12194365 - 12194333
Alignment:
| Q |
234 |
aaactaaccgagcgtgagagtgttgggactttg |
266 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
12194365 |
aaactaaccgagcgtgagagtgttaggactttg |
12194333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University