View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16497_high_2 (Length: 321)
Name: NF16497_high_2
Description: NF16497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16497_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 10 - 306
Target Start/End: Original strand, 51367453 - 51367749
Alignment:
| Q |
10 |
attattctggacttagttttagttttcattaacgttgattttctctgcatggagaggtttctctcaaacgaagcattcgaggaacacctcaaaacctcac |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367453 |
attaatctggacttagttttagttttcattaacgttgattttctctgcatggagaggtttctctcaaacgaagcattcgaggaacacctcaaaacctcac |
51367552 |
T |
 |
| Q |
110 |
aatcaccaccaccatgacccgccggtgatggagaacgacgacggtcgtgattagggggttgtggaggccgggcatactcacccattgacggcgagtcttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51367553 |
aatcaccaccaccatgacccgccggtgatggagaacgacgacggtcgtgattagggggttgtggaggccgggcatactcacccattgaaggcgagtcttt |
51367652 |
T |
 |
| Q |
210 |
gctgtgtcttctccgaacaggatcgttcaccacggcatcaataccattcgaattagaagctggttcctcgaaacttactttcaactcgcgttgaata |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51367653 |
gctgtgtcttctccgaacaggatcgttcaccacggcatcaatcccattcgaattagaagctggttcctcgaaacttactttcaactcgcgttgaata |
51367749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University