View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16497_low_4 (Length: 251)
Name: NF16497_low_4
Description: NF16497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16497_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 44173201 - 44172965
Alignment:
| Q |
14 |
atgaaacaaacctcattttcaactgcaaaaagatgcatgggtcatgaaaactcgatgaagggggttgatacatcaattgaattgacaccgctcaacaggg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44173201 |
atgaaacaaacctcattttcaactgcaaaaagatgcatgggtcatgaaaactcgatgaagggggctgatacatcaattgaattgacaccgctcaacaggg |
44173102 |
T |
 |
| Q |
114 |
tatagctaaacgtgtatgaatttgtcgataaggaaactagggagtgcgtacttaattannnnnnnagaggaggaaagtacaaacttaaaaacgcacattt |
213 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44173101 |
tatagctaaacgtgtatgaa-ttgacgataaggaaactagggagtgcgtacttaattatttttttagaggaggaaagtacaaacttaaaaacgcacattt |
44173003 |
T |
 |
| Q |
214 |
tccttacatagaaaattaaggagcatatcaacaactga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44173002 |
tccttacatagaaaattaaggagcatatcaacaactga |
44172965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University