View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16498_low_3 (Length: 220)
Name: NF16498_low_3
Description: NF16498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16498_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 18263911 - 18263733
Alignment:
| Q |
13 |
gaacctgtgacctcaaggagaatgtactaataggagtaactaactacatcacttactttctcaattgaagattctagatttgtagttttgatgcgtgata |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18263911 |
gaacctgggacctcaaggagaatgtactaataggagtaactaactacatcacttactttctcaattgaagattctagatttgtagttttgatgcgtgata |
18263812 |
T |
 |
| Q |
113 |
aaggagttttctcttctcttccaattgatccttgatttggagattctgctgcaaacccattgttctccaatttcctttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18263811 |
aaggagttttctcttctcttccaattgatccttgatttggagattctgctgcaaacccattgttctccaatttcctttt |
18263733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 211
Target Start/End: Complemental strand, 22302900 - 22302872
Alignment:
| Q |
183 |
tttccttttattttccattcttagtgatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22302900 |
tttccttttattttccattcttagtgatg |
22302872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University