View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1649_high_6 (Length: 344)
Name: NF1649_high_6
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1649_high_6 |
 | |
|
| [»] scaffold1333 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold1333 (Bit Score: 69; Significance: 6e-31; HSPs: 3)
Name: scaffold1333
Description:
Target: scaffold1333; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 256 - 328
Target Start/End: Complemental strand, 1177 - 1105
Alignment:
| Q |
256 |
ataaatttattgtgtactcatcttccataatctcacaaaataaatatagtttctctttgagttccaagttcat |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1177 |
ataaatttattgtgtactcatcttccataatctcacaaaataaatatagttcctctttgagttccaagttcat |
1105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 1291 - 1226
Alignment:
| Q |
18 |
gttctcaacctaaaataaatacaggctgaagttcaataagcgaattaaaatgcaaaatagtgatgg |
83 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1291 |
gttctcaacctaaaatgaatacaggctgaagttcaataagcgaattaaaatgcaaaatagtgatgg |
1226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1333; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 1214 - 1174
Alignment:
| Q |
116 |
atgcttcttaaaagacacagattaaaccatgtgtcagataa |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1214 |
atgcttcttaaaagacagagattaaaccatgtgtcagataa |
1174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University