View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1649_low_14 (Length: 239)
Name: NF1649_low_14
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1649_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 7 - 195
Target Start/End: Complemental strand, 30421875 - 30421687
Alignment:
| Q |
7 |
gtgagatgaaaggcaaggaatgataaaattttcaatgctaaggagacgggggtgatggagttggtggatgatattaaagttttgtcgtggcggtggggtc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30421875 |
gtgatatgaaaggcaaggaatgataaaattttcaatgctaaggagacgggggtgatggagttggtggatgatattaaagttttgtcgtggcggtggtgtc |
30421776 |
T |
|
| Q |
107 |
taactcgtttaaaaagccctgctttgccttttctacgaatggtgttggaaccctttggcgtgccttgtgagatagcttttgttgactgg |
195 |
Q |
| |
|
||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30421775 |
taagtcgtttaaaaagcgctgcttttccttttctacgaatggtgttggaaccctttggcgtgccttgtgagatagcttttgttgactgg |
30421687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 6495420 - 6495583
Alignment:
| Q |
22 |
aggaatgataaaattttcaatgctaaggagacgggggtgatggagttggtggatgatattaaagttttgtcgtggcggtggggtctaactcgtttaaaaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| | ||| |
|
|
| T |
6495420 |
aggaatgataaaattttcaatgctaaggagacgggggtgatggagttggtggatgatattaaagttttg-cgtggtggtggtgtctaactcgagtgcaaa |
6495518 |
T |
|
| Q |
122 |
gccctgctttgccttttctacgaatggtgttggaaccctttggcgtgccttgtgagatagcttttg |
187 |
Q |
| |
|
|| ||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6495519 |
gctctg-tttgcctttactacgaatggtgttggaaccctttggcgtgccttgcgagatagcttttg |
6495583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 83
Target Start/End: Complemental strand, 27714073 - 27714015
Alignment:
| Q |
25 |
aatgataaaattttcaatgctaaggagacgggggtgatggagttggtggatgatattaa |
83 |
Q |
| |
|
||||||||||| |||||||||||||| ||| ||||||||| ||||||||||| ||||| |
|
|
| T |
27714073 |
aatgataaaatcttcaatgctaaggattcggaggtgatggaattggtggatgaaattaa |
27714015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 121
Target Start/End: Original strand, 12830743 - 12830824
Alignment:
| Q |
40 |
aatgctaaggagacgggggtgatggagttggtggatgatattaaagttttgtcgtggcggtggggtctaactcgtttaaaaa |
121 |
Q |
| |
|
||||| ||||| || | |||||||||||||||||| ||||||||||| ||||| || || ||| || ||||||| ||||||| |
|
|
| T |
12830743 |
aatgcaaaggaaacagaggtgatggagttggtggacgatattaaagtattgtcttgccgatggtgtttaactcgcttaaaaa |
12830824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 121
Target Start/End: Original strand, 27322910 - 27322974
Alignment:
| Q |
57 |
ggtgatggagttggtggatgatattaaagttttgtcgtggcggtggggtctaactcgtttaaaaa |
121 |
Q |
| |
|
|||| |||| |||||||| ||||||||||| |||| ||||||||| || |||||| |||||||| |
|
|
| T |
27322910 |
ggtgttggaattggtggacgatattaaagtggtgtcttggcggtggtgtttaactcatttaaaaa |
27322974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37540 times since January 2019
Visitors: 1232