View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1649_low_21 (Length: 208)
Name: NF1649_low_21
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1649_low_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 49914170 - 49914370
Alignment:
| Q |
8 |
gcagaacctgtgcatggagttgaactttacttttgcccacctcataagaaaacagttgaaatgctcagcaagatacttccaaaggaacaaattgaagcag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914170 |
gcagaacctgtgcatggagttgaactttacttttgcccacctcataagaaaacagttgaaatgctcagcaagatacttccaaaggaacaaattgaagcag |
49914269 |
T |
|
| Q |
108 |
ttaattctattgataatggtctaattggtattattgtatggagaaaaactaatataactacatctatatctcccaccgcgcaatcacatcacaaacatag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914270 |
ttaattctattgataatggtctaattggtattattgtatggagaaaaactaatataactacatctatatctcccaccgcgcaatcacatcacaaacatag |
49914369 |
T |
|
| Q |
208 |
c |
208 |
Q |
| |
|
| |
|
|
| T |
49914370 |
c |
49914370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15261 times since January 2019
Visitors: 1259