View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1649_low_22 (Length: 202)
Name: NF1649_low_22
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1649_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 23 - 126
Target Start/End: Complemental strand, 26579160 - 26579057
Alignment:
| Q |
23 |
aagggtttttctattaatgtctcttctcctttgagcaataaattatgtaacattttttatcgtaagatgttaggacataacaaaagtttttataatatac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
26579160 |
aagggtttttctattaatgtctcttctcctttgagcaataaattacgtaacagtttttattgtaagatgttaggacataacaaaggtttttatactataa |
26579061 |
T |
 |
| Q |
123 |
acga |
126 |
Q |
| |
|
|||| |
|
|
| T |
26579060 |
acga |
26579057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University