View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1649_low_9 (Length: 286)
Name: NF1649_low_9
Description: NF1649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1649_low_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 7 - 286
Target Start/End: Complemental strand, 21853160 - 21852880
Alignment:
| Q |
7 |
gcaagatgattcagtatcatatatactactctttatggagtagcatcaaagatgaatacaatgcgattaaagagaattcagtttggctgcttggcaaagg |
106 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21853160 |
gcaagatgattcagtatcatatatactcctctttatggagtagcatcaaagatgaatacaatgtgattaaagagaattcagtttggctgcttggcaaagg |
21853061 |
T |
 |
| Q |
107 |
agataaaataaacttctgg-aatgactattggtgtggtcagtctcttgccactctttttaatatcgcagatcacatttctagtcttctcacatcttctgt |
205 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21853060 |
agataaaataaacttctggtaatgactattggtgtggtcagtctcttgcttctctttttaatatcccagatcacatttctagtcttctcacatcttctgt |
21852961 |
T |
 |
| Q |
206 |
gagtgattacattcataatggttattggaatataccagttggcttgcaattgaagtttcttaatcttcttcacattttctt |
286 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21852960 |
gagtgattacattcataatgtttattggaatataccagttggcttgcaattgaagtttcttaatcttcttcacattttctt |
21852880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 226
Target Start/End: Complemental strand, 32248305 - 32248181
Alignment:
| Q |
102 |
aaaggagataaaataaacttctggaatgactattggtgtggtcagtctcttgccactctttttaatatcgcagatcacatttctagtcttctcacatctt |
201 |
Q |
| |
|
|||||| |||| || || || |||||||||| |||||||||| | ||| | || |||||| || ||| |||| |||||| |||||||||||||||| |
|
|
| T |
32248305 |
aaaggaaataacattaatttttggaatgactgttggtgtggtgaatctttagctgctctttacaacatcccagaccacattagcagtcttctcacatctt |
32248206 |
T |
 |
| Q |
202 |
ctgtgagtgattacattcataatgg |
226 |
Q |
| |
|
| |||||||| || ||||| ||||| |
|
|
| T |
32248205 |
cagtgagtgactatattcacaatgg |
32248181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University