View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16500_low_4 (Length: 268)
Name: NF16500_low_4
Description: NF16500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16500_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 99 - 258
Target Start/End: Original strand, 6980345 - 6980507
Alignment:
| Q |
99 |
cacattggataactaacatttagtgacaaaatacccctaaatcagtcnnnnnnncaggcatcagtcaaattcaataaatttcctattccgtatttagttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||| | ||| ||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
6980345 |
cacattggataactaacatttagtgataaaatacctctaaatcagtctttttttccggcctcagtcaaattcaataagtttcgtattctctatttagttt |
6980444 |
T |
|
| Q |
199 |
tgccaaaagtcata---tttattagtgctaatatctcaattccatttattactttatgatgat |
258 |
Q |
| |
|
|| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6980445 |
tgtcaaaagtcatagtatttattagtgctaatatctcaattccatttattactttatgatgat |
6980507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 15 - 101
Target Start/End: Original strand, 6980039 - 6980125
Alignment:
| Q |
15 |
gaatcacaactaacccaacttgtagaacatcgcacacccttatcttgaaggcaagctcttgttagtagacaaccacaacacatacac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6980039 |
gaatcacaactaacccaacttgtagaacaccgcacacccttatcttgaaggcaagctcttgttagtagacaaccacaacacatacac |
6980125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University