View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16500_low_6 (Length: 216)
Name: NF16500_low_6
Description: NF16500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16500_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 44545743 - 44545562
Alignment:
| Q |
15 |
agttggaatggggacagtgcttaatgtgtgaaaggggaagtgggaagaactgatgtcaaatgtgaattatgaatgcacgcttgaacagtttaagatgtag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44545743 |
agttggaatggggacagtgcttaatgtgtgaaagggaaagtgggaagaactgatgtcaaatgtgaattatgaatgcttgcttgaacagtttaagatgtag |
44545644 |
T |
 |
| Q |
115 |
cgaacatattatgatgtagaagggagttaagtctttaatttgtagcatcattcaggtcctagatccaaacttcattgcttcca |
197 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44545643 |
cgaacatattatggtgtagaagagagtt-agtctttaatttgtagcatcattcaggtcctagatccaaacttcattgcttcca |
44545562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University