View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16501_low_2 (Length: 279)
Name: NF16501_low_2
Description: NF16501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16501_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 9871944 - 9872213
Alignment:
| Q |
1 |
tcatcaccttcagtgtaggagtgtaactatgatgcttgtgctataataatggaagaactcatttctttgtcatcgaactggtataaagattttctcttca |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9871944 |
tcatcaacttcagtgtaggagtgtaactatgacgcttgtgctata-taatggaagaactcatttctttgtcatcgaactggtataaagattttctcttca |
9872042 |
T |
 |
| Q |
101 |
attcacatatgagaggaatatttgctttacctttgattacgttgaagttgaaactcttcaacttgatcatagatttagcaatattcaccatgtcaatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872043 |
attcacatatgagaggaatatttgctttacctttgattacgttgaagttgaaactcttcaacttgatcatagatttagcaatattcaccatgtcaatgat |
9872142 |
T |
 |
| Q |
201 |
ttactagacacattttgaagggttcttnnnnnnngatctcttcgttattagttcaatagtattattttagt |
271 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9872143 |
ttactacacacattttgaagggttcttaaaaaaagatctcttcgttattagttcattagtattattttagt |
9872213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University