View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16502_low_23 (Length: 262)
Name: NF16502_low_23
Description: NF16502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16502_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 256
Target Start/End: Original strand, 409428 - 409663
Alignment:
| Q |
21 |
gaaaaaccaacgatcttggtctccgagaaactcggagaagcagggctacaagtgttaagacaattaggacatgtggaatgtgcttatgatctttcaccag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
409428 |
gaaaaaccaacgatcttggtctccgagaaactaggagaagcagggctacaagtgttaagacaattaggaaatgtggaatgtgcatatgatctttcaccag |
409527 |
T |
 |
| Q |
121 |
aagacctatgcaagaagatctcaagctgtgatgctttgattgtgagaagcggtacgaaagttacaaggcaagtgtttgaagcaggaaaaggaaagttgaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
409528 |
aagacctatgcaagaagatctcaagctgtgatgctttgattgtgagaagcggtacgaaagttacaaggaaagtgtttgaagcagggaaaggaaagttgaa |
409627 |
T |
 |
| Q |
221 |
agttgttggtagagctggtgttgggattgatgatgt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
409628 |
agttgttggtagagctggtgttgggattgataatgt |
409663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University