View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16502_low_26 (Length: 254)
Name: NF16502_low_26
Description: NF16502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16502_low_26 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 39682235 - 39681996
Alignment:
| Q |
15 |
caaaggttgcgtttattgtgatacttgccgtgctggattcgaaaccaacgccacattttacatccaaggtacatacatacacatcactttgtatacacct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
39682235 |
caaaggttgcgtttattgtgatacttgccgtgctggattcgaaaccaacgccacattttacatccaaggtacatatatacacatcactttctatacacct |
39682136 |
T |
 |
| Q |
115 |
tagcgtaaaaagtttttagactgtctatgattgaagtcaaacattttaatgatcaggtgtatgttttacacatgattaggtgtacgtttttaaacatatc |
214 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39682135 |
tagcgtaaaaagtttttacactgtctacgattgaagtcaaacattttaatgatcaggtgtatgttttacacctgattaggtgtacgtttttaaacatatc |
39682036 |
T |
 |
| Q |
215 |
actttttacaccttagtgtaaaaaggtttgcaccgtttgc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39682035 |
actttttacaccttagtgtaaaaaggtttgcaccgtttgc |
39681996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 168
Target Start/End: Original strand, 27032048 - 27032076
Alignment:
| Q |
140 |
tatgattgaagtcaaacattttaatgatc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27032048 |
tatgattgaagtcaaacattttaatgatc |
27032076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University