View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16502_low_31 (Length: 224)
Name: NF16502_low_31
Description: NF16502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16502_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 137618 - 137427
Alignment:
| Q |
16 |
aagaaagggttgaatttaattgagaatgaattaaggagagcaattttcggatcgatcaaagtggagaagttgaccactacattttgggcaatcttcaact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137618 |
aagaaagggttgaatttaattgagaatgaattaaggagagcaattttcggatcgatcaaagtggagaagttgaccactacattttgggcaatcttcaact |
137519 |
T |
 |
| Q |
116 |
tgttttggcaccatgaaatacatgagacagatcttgcaaccagcaactacaagaacattctgtttctctattacttctctttgatcatactg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137518 |
tgttttggcaccatgaaatacatgagacagatcttgcaaccagcaactacaagaacattctgtttctctattacttctctttgatcatactg |
137427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University