View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16503_low_15 (Length: 381)
Name: NF16503_low_15
Description: NF16503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16503_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 81 - 371
Target Start/End: Original strand, 13766383 - 13766676
Alignment:
| Q |
81 |
aaggtccttgctttgcgtttagctcatatcatggagaaaattattttcgccaaccaatcggccttcgttagagggagacaacatgtagatggggttgtgg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766383 |
aaggtccttgctttgcgtttagctcatatcatggagaagattattttcgtaaaccaatcgaccttcgttagagggagacaacatgtagatggggttgtgg |
13766482 |
T |
|
| Q |
181 |
ctgtaaatgagattattgttttgaggggagatggggtcgtgga-tatagtgtgtgtgtttacaggtagcctgctgtcctggtcaattgttctcctaccta |
279 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||||||||||||| || |||||||||||||| | |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13766483 |
ctataaatgagattattgttttgatgggagatggggtcgtggactagagtgtgtgtgtttataagtagcctgctatcctggtcaattgttctcctaccta |
13766582 |
T |
|
| Q |
280 |
agaaatagacattcaaaaagggctcaagcaaggag--acggtgttttttgtctgtgaagaagaacttttgactggtatggtggatattcttcga |
371 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13766583 |
agaaatcgatattcaaaaagggctcaagcaaggagacacggtgttttttgtctatgaggaagaacttttgactggtatggtggatatccttcga |
13766676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 13766286 - 13766347
Alignment:
| Q |
20 |
atactttgttaccttgatctctaaggttgaatatcccatacttttaggggattttagcctga |
81 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766286 |
atactttcttaccttgatctctaaggttgaatatcccatacttttaggggattttagcctga |
13766347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University