View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16503_low_22 (Length: 297)
Name: NF16503_low_22
Description: NF16503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16503_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 42393187 - 42393450
Alignment:
| Q |
19 |
ctctcttggaacaatgacacgaggagtgctagttttaatacttttgatgctgatgcaatttttcaaatgccgctttttagcagagatatcatggactgtc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42393187 |
ctctcttggaacaatgacacgaggagtgctagttttaatacttttgatgctgatgcaatttttcaaatgcctctttttagcagagatatcatggactgtc |
42393286 |
T |
|
| Q |
119 |
gtatctggaatgtgtcaagtgatggaaaattttctgtcaagtcttcatacagcttacgtatgaagctaattgctaattgttgaacctgctcatgaattca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42393287 |
gtatctggaatgtgtcaagtgatggaaaatattctgtcaagtcttcatacagcttacgtatgaggctaattgctaattgttgaacctgctcgtgaattca |
42393386 |
T |
|
| Q |
219 |
ttcaacgcaattggagtgtaatttggaaactgcatattcctacatgcgtccgccccttcctatg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393387 |
ttcaacgcaattggagtgtaatttggaaactgcatattcctacatgcgtccgccccttcctatg |
42393450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University