View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_19 (Length: 402)
Name: NF16504_high_19
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 358 - 402
Target Start/End: Complemental strand, 6241800 - 6241756
Alignment:
| Q |
358 |
tatcggtttaatatttccattttgcaaataaaattgaatgacttt |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6241800 |
tatcggtttaatatttccattttgcaaataaaaatgaatgacttt |
6241756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 295
Target Start/End: Complemental strand, 8368770 - 8368659
Alignment:
| Q |
184 |
ttttctcatttttccaagagagagtgcataagaatatcaagggatggaaggaaaaatgtctttctcgtgccgggaaggaaactttaatcaaggcagtagc |
283 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||| ||||| || ||||| || |||||||| || ||||| ||||| |||||||||||||| ||||| || |
|
|
| T |
8368770 |
ttttctcctttgtccaagagagagtgtggaagaagatcaaaggctggaaagagaaatgtctctcccgtgctgggaaagaaactttaatcaaagcagttgc |
8368671 |
T |
|
| Q |
284 |
tcaagcaatccc |
295 |
Q |
| |
|
||| || ||||| |
|
|
| T |
8368670 |
tcaggctatccc |
8368659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 142
Target Start/End: Complemental strand, 20925301 - 20925244
Alignment:
| Q |
85 |
aaaaagaaatgatctgtgatcagattaatataaagattgtgtcatctcatactagata |
142 |
Q |
| |
|
||||||||||||||||| ||||||| ||| |||||| |||| |||||||||||||| |
|
|
| T |
20925301 |
aaaaagaaatgatctgtaatcagatgaatgtaaagactgtgatgtctcatactagata |
20925244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University