View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_37 (Length: 314)
Name: NF16504_high_37
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 30956419 - 30956111
Alignment:
| Q |
1 |
tccccaaaggcaagtactagtgtttgtggtggtgccttaattgttttttccagttggaaatattcaaatggag---ttgtgttttttgcttgataactga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30956419 |
tccccaaaggcaagtactagtgtttgtggtggtgccttaattgttttttccagttggaaatattcaaatggagcagttgtgttttttgcttgataactga |
30956320 |
T |
|
| Q |
98 |
ggaaactaacacataccagcagtagggcccagtgatacttgggaggaatgtcaagcacactgtcacatgcgtgacttataaacgccttccatgtcaacga |
197 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30956319 |
ggaaactaacacatatcagcagtaaggcccagtgatacttgggaggaatgtcaagcacactgtcacatgcgtgacttataaacgccttccatgtcaacga |
30956220 |
T |
|
| Q |
198 |
tttcttttcccgtgtgtttcctaattttttcaaggataaaggaagaccagattctctttttgcctgaagaaaaacatgaaatatccaatcaaagtagttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30956219 |
tttcttttcccgtgtgtttcctaattttttcaaggataaaggaagaccagattctctttttgcctgaagaaaaacatgaaatatcgaatcaaagtagttt |
30956120 |
T |
|
| Q |
298 |
cagaataat |
306 |
Q |
| |
|
||||||||| |
|
|
| T |
30956119 |
cagaataat |
30956111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University