View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_45 (Length: 276)
Name: NF16504_high_45
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 28001215 - 28000954
Alignment:
| Q |
20 |
cggatctcattcttgcagccacttccatctatggggaagcccactggaattgcatatggggagcatgcaaattccgccccgagttcgtgccattatttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001215 |
cggatctcattcttgcagccacttccatctatggggaagcccactggaattgcatatggggagcatgcaaattccgccccgagttcgtgccattatttgg |
28001116 |
T |
|
| Q |
120 |
cgtcttgctcatcaatgcttgcctaaacatgtcaacctcctcaatcatggcattccttgtgatgactcttgtgtttcttgtgatctcctcactaacata- |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001115 |
cgtctcgctcatcaatgcttgcctaaacatgtcaacctcctcaatcatggcattccttgtgatgactcttgtgtttcttgtgatctcctcactaacatac |
28001016 |
T |
|
| Q |
219 |
---------------ttgtttgctcaaaggctactagttcttgggaattgtttggccttcat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001015 |
aaatatataccttttttgtttgctcaaaggctactagttcttgggaattgtttggccttcat |
28000954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 112 - 212
Target Start/End: Complemental strand, 27950842 - 27950742
Alignment:
| Q |
112 |
ttatttggcgtcttgctcatcaatgcttgcctaaacatgtcaacctcctcaatcatggcattccttgtgatgactcttgtgtttcttgtgatctcctcac |
211 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27950842 |
ttatttggcgcctcgctcatcaatgcttgcctacatgtgtcaaactcctcaatcatggcattccttgtgatgactcttgtgtttcttgtgatctcctcac |
27950743 |
T |
|
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
27950742 |
t |
27950742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 27950683 - 27950642
Alignment:
| Q |
224 |
tgctcaaaggctactagttcttgggaattgtttggccttcat |
265 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27950683 |
tgctccaaggctactagttcttggaaattgtttggccttcat |
27950642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 219 - 254
Target Start/End: Complemental strand, 27950718 - 27950683
Alignment:
| Q |
219 |
ttgtttgctcaaaggctactagttcttgggaattgt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27950718 |
ttgtttgctcaaaggctactagttcttggaaattgt |
27950683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 115 - 144
Target Start/End: Complemental strand, 21730675 - 21730646
Alignment:
| Q |
115 |
tttggcgtcttgctcatcaatgcttgccta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21730675 |
tttggcgtcttgctcatcaatgcttgccta |
21730646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University