View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_54 (Length: 247)
Name: NF16504_high_54
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 42217207 - 42216966
Alignment:
| Q |
1 |
ttagaagatgcatgtgaaactatgttcttagcatgcactactgaaactccctttaatacattctaagcaaagtatcgaaattggttgagcattgcaacag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217207 |
ttagaagatgcatgtgaaactatattcttagcatgcactactgaaactccctttaatacattctaagcaaagtatcgaaattggttgagcattgcaacag |
42217108 |
T |
 |
| Q |
101 |
tgtccttcattgttggacggtcataagcttttgtactaacacatagtaatgacacagctagagtctgtagtatttcatgcataacagtaggtttagtccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217107 |
tgtccttcattgttggacggtcataagcttttgtactgacacatagtaatgacacagctagagtctgtagtatttcatgcataacagtaggtttagtccc |
42217008 |
T |
 |
| Q |
201 |
tctaagatttgagtcaagaattccagatgggtctcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217007 |
tctaagatttgagtcaagaattccagatgggtctcctttgct |
42216966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 182
Target Start/End: Complemental strand, 24159064 - 24158967
Alignment:
| Q |
85 |
ttgagcattgcaacagtgtccttcattgttggacggtcataagcttttgtactaacacatagtaatgacacagctagagtctgtagtatttcatgcat |
182 |
Q |
| |
|
||||||||||||||| | || ||||||| |||||||||| |||| | || || |||||||| |||||||| |||| ||| ||||| ||||||||||| |
|
|
| T |
24159064 |
ttgagcattgcaacaatatctttcattgctggacggtcagcagctctagtgcttacacatagaaatgacactgctaaagtttgtagcatttcatgcat |
24158967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University