View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_55 (Length: 237)
Name: NF16504_high_55
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 45405880 - 45405686
Alignment:
| Q |
1 |
cacaaaaactctgattcgattgattgagacgcaagtaaaatcttattattattgttttagttagaatttgaacttgaattctctcgaacaaactgctttt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45405880 |
cacaaacactctgattcgattgattgagacgcaagtaaaatcttattattattgttttagttagaatttgaacttgaattctctcgaacaaactgctttt |
45405781 |
T |
|
| Q |
101 |
aactgaaactcattagctacttgaattcaatcgcttgattaagtataatatggttcggtgtgtgaatattttgtctgacataaatgagtttctcc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45405780 |
aactgaaactcattagctacttgaattcaatcgcttgattaagtataatatggttggatgtgtgaatattttgtctgacataaatgagtttctcc |
45405686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University