View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_high_61 (Length: 225)
Name: NF16504_high_61
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_high_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 27098898 - 27098703
Alignment:
| Q |
14 |
aagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098898 |
aagaacttgatgaagagattgaaaggttttgtgaaagtgttggtgtgagtagacaagtttttaaggtttggatgcataatcataagaattcttgtttctc |
27098799 |
T |
 |
| Q |
114 |
aaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatttcactaatcaaatct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098798 |
aaattcttctgatccttctactggtaatgctaattcctctcttactcagtagtgtgtgtgaagaatttcaattacttcatttcactaatcaaatct |
27098703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University