View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16504_high_66 (Length: 210)

Name: NF16504_high_66
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16504_high_66
NF16504_high_66
[»] chr1 (1 HSPs)
chr1 (15-194)||(46896558-46896737)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 46896737 - 46896558
Alignment:
15 atgaatgttaaatcataaaaaatggttgtagtattgtatcatcactaagatataatggatgagaaagttttaagaagtttggaattaataaacatctaaa 114  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46896737 atgaatgttaaattataaaaaatggttgtagtattgtatcatcactaagatataatggatgagaaagttttaagaagtttggaattaataaacatctaaa 46896638  T
115 ttcgatctgaaatgcatgagagtacaatatgtatgatctgtatgctaagatcataggaaagggtgatggcataatattat 194  Q
    |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| || ||||||||||||||||||    
46896637 ttcgatctgaaatgcatgagagtacactatgtatgatatgtatgctaagatcataggagagtgtgatggcataatattat 46896558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University