View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_25 (Length: 421)
Name: NF16504_low_25
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 246 - 417
Target Start/End: Original strand, 52888192 - 52888363
Alignment:
| Q |
246 |
cttcccatcctcaatatgcaattcttaattcctttttgaatttcacttctccgttgtcactgtttattactcgcaaccacttgccaaaaatgtcttcgtg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
52888192 |
cttcccatcctcaatatgcaattcttaattcctttttgaatttcacttctcctttgtcactgtttattacttgcaaccacttgccaaaaatgtcttcttg |
52888291 |
T |
 |
| Q |
346 |
ttttagtggaacaggaggaagaaccatcggtttggatttagatatagttaaatcatcaccaccatgttcatg |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888292 |
ttttagtggaacaggaggaagaaccatcggtttggatttagatatagttaaatcatcaccaccatgttcatg |
52888363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 9 - 153
Target Start/End: Original strand, 52887944 - 52888098
Alignment:
| Q |
9 |
gcaatgccctgttcctgttttaactcacttttcccttaattcatataaattccggaattgcagaattttcaaact----------ttgnnnnnnnnnnnn |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52887944 |
gcaatgccctgttcctgttttaactcacttttcccttaattcatataaattccggaattgcagaattttcaaacttttttttttttttttttttttttta |
52888043 |
T |
 |
| Q |
99 |
aaaaccaatcaatttcaggttctttgttctttctctatattctaaactaaacccc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888044 |
aaaaccaatcaatttcaggttctttgttctttctctatattctaaactaaacccc |
52888098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University