View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16504_low_29 (Length: 402)

Name: NF16504_low_29
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16504_low_29
NF16504_low_29
[»] chr7 (1 HSPs)
chr7 (358-402)||(6241756-6241800)
[»] chr1 (1 HSPs)
chr1 (184-295)||(8368659-8368770)
[»] chr5 (1 HSPs)
chr5 (85-142)||(20925244-20925301)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 358 - 402
Target Start/End: Complemental strand, 6241800 - 6241756
Alignment:
358 tatcggtttaatatttccattttgcaaataaaattgaatgacttt 402  Q
    ||||||||||||||||||||||||||||||||| |||||||||||    
6241800 tatcggtttaatatttccattttgcaaataaaaatgaatgacttt 6241756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 184 - 295
Target Start/End: Complemental strand, 8368770 - 8368659
Alignment:
184 ttttctcatttttccaagagagagtgcataagaatatcaagggatggaaggaaaaatgtctttctcgtgccgggaaggaaactttaatcaaggcagtagc 283  Q
    ||||||| ||| ||||||||||||||   ||||| ||||| || ||||| || |||||||| || ||||| ||||| |||||||||||||| ||||| ||    
8368770 ttttctcctttgtccaagagagagtgtggaagaagatcaaaggctggaaagagaaatgtctctcccgtgctgggaaagaaactttaatcaaagcagttgc 8368671  T
284 tcaagcaatccc 295  Q
    ||| || |||||    
8368670 tcaggctatccc 8368659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 85 - 142
Target Start/End: Complemental strand, 20925301 - 20925244
Alignment:
85 aaaaagaaatgatctgtgatcagattaatataaagattgtgtcatctcatactagata 142  Q
    ||||||||||||||||| ||||||| ||| |||||| ||||   ||||||||||||||    
20925301 aaaaagaaatgatctgtaatcagatgaatgtaaagactgtgatgtctcatactagata 20925244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University