View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_42 (Length: 339)
Name: NF16504_low_42
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 19 - 327
Target Start/End: Original strand, 45143946 - 45144254
Alignment:
| Q |
19 |
cacctcctccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccgatata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143946 |
cacctcctccaccaacagcttttcttggcaaaccctgaataacctctcccaacaaaccctcttccacaaccttcaacatctcttcagcaccaccgatata |
45144045 |
T |
 |
| Q |
119 |
atatcccttcacaaacactctcggcggaatcaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcacgctcg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144046 |
atatcccttcacaaacactctcggcggaaccaccatcttctctttcagaagctccctcagttcctctttaaacccactatccatcgaaacgtcacgctcg |
45144145 |
T |
 |
| Q |
219 |
catatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcaccactt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144146 |
catatttgtacaccaaatgcatcaaaagctgctctcaccgcattgcaagcctcaaatgtcctccgaacacctctcaacgttgttgtatagatcaccactt |
45144245 |
T |
 |
| Q |
319 |
tcttctctc |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
45144246 |
tcttctctc |
45144254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University