View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_60 (Length: 272)
Name: NF16504_low_60
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 23780805 - 23780564
Alignment:
| Q |
13 |
agatgaacgaaaagtattaataagttgaagcaattctctatttgttacattcatcgtgaagctaactaaattgtggattcttttacaagatttgattaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23780805 |
agatgaacgaaaagtattaataagttgaagcaattctctatttgttacattcatcgtgaagctaactaaattgcggattcttttacaagatttgattaaa |
23780706 |
T |
 |
| Q |
113 |
tatcttaatattagtgttgaacgttttatgttatctttgattttgtttcttttgctttgttaagagatagaaatgttattgcatttcctagaagctttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23780705 |
tatcttaatattagtgttgaacgttttatgttatctttgattttgtttcttttgctttgttaagagatagaaatgttattgcatttcctagaagctttta |
23780606 |
T |
 |
| Q |
213 |
gtctctcttttt-tgtgtttgatttccatatcttcacacaac |
253 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23780605 |
gtctctttttttgtgtgtttgatttccatatcttcacacaac |
23780564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University