View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16504_low_63 (Length: 255)

Name: NF16504_low_63
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16504_low_63
NF16504_low_63
[»] chr1 (1 HSPs)
chr1 (70-255)||(37296235-37296420)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 70 - 255
Target Start/End: Complemental strand, 37296420 - 37296235
Alignment:
70 gtcacttcctcatcacaatccaaaaccctaatcctctttcagatcacaataatggacggtgattcctcttggtcttctcgtctctcttccgcttccagac 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
37296420 gtcacttcctcatcacaatccaaaaccctaatcctctttcagatcacaatcatggacggtgattcttcttggtcttctcgtctctcttccgcttccagac 37296321  T
170 gttatcaagccgctcttcaatcccgatcaggttccttcttcttctcgaaacccctttcccccaatttctttctctctacctcaatt 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37296320 gttatcaagccgctcttcaatcccgatcaggttccttcttcttctcgaaacccctttcccccaatttctttctctctacctcaatt 37296235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University