View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_63 (Length: 255)
Name: NF16504_low_63
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_63 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 70 - 255
Target Start/End: Complemental strand, 37296420 - 37296235
Alignment:
| Q |
70 |
gtcacttcctcatcacaatccaaaaccctaatcctctttcagatcacaataatggacggtgattcctcttggtcttctcgtctctcttccgcttccagac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37296420 |
gtcacttcctcatcacaatccaaaaccctaatcctctttcagatcacaatcatggacggtgattcttcttggtcttctcgtctctcttccgcttccagac |
37296321 |
T |
|
| Q |
170 |
gttatcaagccgctcttcaatcccgatcaggttccttcttcttctcgaaacccctttcccccaatttctttctctctacctcaatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37296320 |
gttatcaagccgctcttcaatcccgatcaggttccttcttcttctcgaaacccctttcccccaatttctttctctctacctcaatt |
37296235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University