View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_77 (Length: 219)
Name: NF16504_low_77
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 204
Target Start/End: Original strand, 33128676 - 33128857
Alignment:
| Q |
23 |
aagtttcaatggttttacttatcataatgaagtccatatatactacttcaatttaatcctaagtttgataattgcatgcagtcctgtgtcaggtgcatca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33128676 |
aagtttcaatggttttacttatcataatgaagtccatatatactacttcaatttaatcctaagtttgataattgcacgcagtcctgtgtcaggtgcatca |
33128775 |
T |
 |
| Q |
123 |
atgaacccagccagaacttttgggcctgctgtagtgatgcacatctacaagggattctgggtttatatagttggaccctttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33128776 |
atgaacccagccagaacttttgggcctgctgtagtgatgcacatctacaagggattctgggtttatatagttggaccctttg |
33128857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 196
Target Start/End: Complemental strand, 1703762 - 1703671
Alignment:
| Q |
105 |
cctgtgtcaggtgcatcaatgaacccagccagaacttttgggcctgctgtagtgatgcacatctacaagggattctgggtttatatagttgg |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| | |||| ||||| | ||||| || || ||||| ||||| ||| | ||||||||||| |
|
|
| T |
1703762 |
cctgtgtcaggtgcatctatgaacccagcaagaagtattggtcctgcaattgtgatacatatttacaaaggattgtggatatatatagttgg |
1703671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University