View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16504_low_78 (Length: 218)

Name: NF16504_low_78
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16504_low_78
NF16504_low_78
[»] chr8 (1 HSPs)
chr8 (8-117)||(9938873-9938983)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 9938873 - 9938983
Alignment:
8 gtctattcccatgtaatctttattcggaaaatgtaattgaggggaggatatttttgaact-tgtattacaaacaaatttgcagctcgaacatatttcttt 106  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||| |||||||||||||    
9938873 gtctattcccatgtaatctttattcgaaaaatgtaattgaggggaggatatttttggactgcgtattacaaacaaatttgcagctcaaacatatttcttt 9938972  T
107 ctcccgatatt 117  Q
    |||||||||||    
9938973 ctcccgatatt 9938983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University