View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_78 (Length: 218)
Name: NF16504_low_78
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 9938873 - 9938983
Alignment:
| Q |
8 |
gtctattcccatgtaatctttattcggaaaatgtaattgaggggaggatatttttgaact-tgtattacaaacaaatttgcagctcgaacatatttcttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9938873 |
gtctattcccatgtaatctttattcgaaaaatgtaattgaggggaggatatttttggactgcgtattacaaacaaatttgcagctcaaacatatttcttt |
9938972 |
T |
 |
| Q |
107 |
ctcccgatatt |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
9938973 |
ctcccgatatt |
9938983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University