View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_81 (Length: 210)
Name: NF16504_low_81
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_81 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 46896737 - 46896558
Alignment:
| Q |
15 |
atgaatgttaaatcataaaaaatggttgtagtattgtatcatcactaagatataatggatgagaaagttttaagaagtttggaattaataaacatctaaa |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46896737 |
atgaatgttaaattataaaaaatggttgtagtattgtatcatcactaagatataatggatgagaaagttttaagaagtttggaattaataaacatctaaa |
46896638 |
T |
|
| Q |
115 |
ttcgatctgaaatgcatgagagtacaatatgtatgatctgtatgctaagatcataggaaagggtgatggcataatattat |
194 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
46896637 |
ttcgatctgaaatgcatgagagtacactatgtatgatatgtatgctaagatcataggagagtgtgatggcataatattat |
46896558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University