View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16504_low_84 (Length: 205)
Name: NF16504_low_84
Description: NF16504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16504_low_84 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 45 - 163
Target Start/End: Complemental strand, 34708779 - 34708661
Alignment:
| Q |
45 |
aagatatgtttagatgtaattactatgtcgtttcctttaatatatttgaaaattctctaaacaggtgtttcgaactaaaatatttttaagaataatgcta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34708779 |
aagatatgtttagatgtaattactatgtcgtttcctttaatatatttgaaaattctctaaacaggtgtttcgaactaaaatatttttaagaataatacta |
34708680 |
T |
|
| Q |
145 |
cttacaacgaaatatatta |
163 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34708679 |
cttacaacgaaatatatta |
34708661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University