View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16505_high_12 (Length: 254)
Name: NF16505_high_12
Description: NF16505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16505_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 32 - 191
Target Start/End: Complemental strand, 10860832 - 10860673
Alignment:
| Q |
32 |
ttgtaatggcactaatcatgctcgtgacacatgctacttcaagcatggttttcctccaaggtatagatacaagaatgcttctcgtagtgtatgcactgat |
131 |
Q |
| |
|
|||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10860832 |
ttgtaatgacactaatcatgctcttgatacatgctacttcaagcatggttttcctccaaggtatagatacaaggatgcttctcgtagtgtatgcactgat |
10860733 |
T |
 |
| Q |
132 |
tctattgcacaagaagttgattctgatgataacaacatggttttggttttgagtttaagc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10860732 |
tctattgcacaagaagttgattctgatgataacaacatggttttggttttgagtttaagc |
10860673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 56 - 164
Target Start/End: Complemental strand, 10905850 - 10905742
Alignment:
| Q |
56 |
tgacacatgctacttcaagcatggttttcctccaaggtatagatacaagaatgcttctcgtagtgtatgcactgattctattgcacaagaagttgattct |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || || |||||| || ||| || | |||||||| |||| ||||| || ||||||||||| |
|
|
| T |
10905850 |
tgacacatgctacttcaagcatggttttcctccaaggtttatattcaagaagtctgctcataaggaatgcactgtttctgttgcataaaaagttgattct |
10905751 |
T |
 |
| Q |
156 |
gatgataac |
164 |
Q |
| |
|
|||||||| |
|
|
| T |
10905750 |
aatgataac |
10905742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University