View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16505_high_15 (Length: 221)
Name: NF16505_high_15
Description: NF16505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16505_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 122 - 195
Target Start/End: Original strand, 31061806 - 31061881
Alignment:
| Q |
122 |
aaatatcatgaatgccatttgcattagttaaagcaacga--gtgttaattagtatatcacatgtattatagttgag |
195 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31061806 |
aaatatcatcaatgtcatttgcattagtcaaagcaacgatagtgttaattagtatatcacatgtattatagttgag |
31061881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University