View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16505_low_15 (Length: 298)
Name: NF16505_low_15
Description: NF16505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16505_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 76 - 280
Target Start/End: Complemental strand, 43763846 - 43763642
Alignment:
| Q |
76 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctattgtactcccttcctccccttcttccacctccatgt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763846 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctattgtactcccttcctccccttcttccacctccatgt |
43763747 |
T |
|
| Q |
176 |
tactaatactccctccttcaccgtccgccgccgcaccgccaccatgccgaaaaatccccgcctgatttgagcaaagaaaatatgttagaacttaagtcta |
275 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763746 |
tactaatactccctccttcaccctccgccgccgcaccgccaccatgccgaaatatccccgcctgatttgagcaaagaaaatatgttagaacttaagtcta |
43763647 |
T |
|
| Q |
276 |
ggaag |
280 |
Q |
| |
|
||||| |
|
|
| T |
43763646 |
ggaag |
43763642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University