View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16506_low_6 (Length: 291)
Name: NF16506_low_6
Description: NF16506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16506_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 53 - 276
Target Start/End: Original strand, 29958652 - 29958880
Alignment:
| Q |
53 |
ttgttatgcaaatgtcacttgtttaaatcaagttctcatatttgtt----ataaaagaaatttagttcaatgctaattttattcaattattaacaaaatg |
148 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958652 |
ttgttatgcaagtgtcacttgtttaaatcaagttctcatatttgtttgttatcaaagaaatttagttcaatgctaattttattcaattattaacaaaatg |
29958751 |
T |
|
| Q |
149 |
cgattact-aagaaaatactaagtactattcactatccatttaaaatgtccacatctttcaatagatatttttataaaaactaatcttaaaatggaacca |
247 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29958752 |
cgattacttaagaaaatactaagcactattcactatccatttaaaatgtccacatctttcaatagatatttctataaaaactaatcttaaaatggaacca |
29958851 |
T |
|
| Q |
248 |
gtaaaaacttaaatacaaaaagtattgag |
276 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
29958852 |
ataaaaacttgaatacaaaaagtattgag |
29958880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 268
Target Start/End: Complemental strand, 3553799 - 3553757
Alignment:
| Q |
226 |
aactaatcttaaaatggaaccagtaaaaacttaaatacaaaaa |
268 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
3553799 |
aactaatcttaaaatggaaccaataaaaacttgaatacaaaaa |
3553757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University